Content Frame
Note for screen reader users: There is text between the form elements on this page. To be sure that you do not miss any text, use item by item navigation methods, rather than tabbing from form element to form element

Key Concepts Quiz



This activity contains 27 questions.

Question 1
1
Open Hint for Question 1 in a new window
Hershey and Chase were able to differentiate between proteins and nucleic acids using radioactive atoms of elements found only in those macromolecules. Which of the following would be found only in proteins?
 
End of Question 1


Question 2
2
Open Hint for Question 2 in a new window
In DNA, one nucleotide monomer is linked to the next through _____.
 
End of Question 2


Question 3
3
Open Hint for Question 3 in a new window
Which of the following is found in RNA but not in DNA?
 
End of Question 3


Question 4
4
Open Hint for Question 4 in a new window
What amount of thymine would be found in a strand of DNA composed of 15% cytosine?
 
End of Question 4


Question 5
5
Open Hint for Question 5 in a new window
Which of the following is true about double-stranded DNA?
 
End of Question 5


Question 6
6
Open Hint for Question 6 in a new window
During replication, the original "parent" DNA _____.
 
End of Question 6


Question 7
7
Open Hint for Question 7 in a new window
Prokaryotic organisms have a single origin of replication, whereas eukaryotic organisms have many origins where replication occurs simultaneously. Which of the following is the most probable reason for this observation?
 
End of Question 7


Question 8
8
Open Hint for Question 8 in a new window
Which of the following occurs during DNA replication?
 
End of Question 8


Question 9
9
Open Hint for Question 9 in a new window
In eukaryotes, translation is initiated only after transcription is completed. However, prokaryotes can initiate translation before a gene is completely transcribed. Which choice is the best explanation for this observation?
 
End of Question 9


Question 10
10
Open Hint for Question 10 in a new window
A new organism is discovered that has six different nucleotides that encode 30 different amino acids. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism?
 
End of Question 10


Question 11
11
Open Hint for Question 11 in a new window
Consider the following sequence and explain what effect the mutation has on the protein that is translated.

UCUAUGUUUCACAGAGGGAAACCCUAACCC (wildtype)

UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

 
End of Question 11


Question 12
12
Open Hint for Question 12 in a new window
In transcription, _____.
 
End of Question 12


Question 13
13
Open Hint for Question 13 in a new window
In eukaryotic cells, a terminator in mRNA synthesis is _____.
 
End of Question 13


Question 14
14
Open Hint for Question 14 in a new window
In eukaryotic cells, the RNA is processed before it leaves the nucleus. This processing _____.
 
End of Question 14


Question 15
15
Open Hint for Question 15 in a new window
What would be the anticodon for the DNA sequence CTC?
 
End of Question 15


Question 16
16
Open Hint for Question 16 in a new window
If protein production were an assembly line, a ribosome would be _____.
 
End of Question 16


Question 17
17
Open Hint for Question 17 in a new window
At the start of translation, where does the initiator tRNA bind?
 
End of Question 17


Question 18
18
Open Hint for Question 18 in a new window
The translation process in eukaryotes requires all of the following: _____.
 
End of Question 18


Question 19
19
Open Hint for Question 19 in a new window
In eukaryotes, the process of transcription is controlled by _____.
 
End of Question 19


Question 20
20
Open Hint for Question 20 in a new window
The type of mutation is represented below is a(n) _____.

The big red fly had one eye (wild type)

The fbi gre dfl yha don eey (mutant)

 
End of Question 20


Question 21
21
Open Hint for Question 21 in a new window
During the lytic cycle, but not the lysogenic cycle, _____.
 
End of Question 21


Question 22
22
Open Hint for Question 22 in a new window
HIV enters a white blood cell and then uses _____ to make copies of its genetic material. Once HIV proteins have been translated, the virus can be released by _____.
 
End of Question 22


Question 23
23
Open Hint for Question 23 in a new window
Emerging viruses can originate from _____.
 
End of Question 23


Question 24
24
Open Hint for Question 24 in a new window
The drug AZT was one of the first drugs used to treat HIV. Which of the following drug actions would prevent the spread of HIV without harming the host cell?
 
End of Question 24


Question 25
25
Open Hint for Question 25 in a new window
Radiation is a frequent method of sterilization. It is effective because it causes damage to DNA. However, prions, the agents that cause diseases such as mad cow disease, are unaffected by these treatments. Why?
 
End of Question 25


Question 26
26
Open Hint for Question 26 in a new window
A microbiologist found that a colony of bacterial clones infected by a phage had developed the ability to make a particular amino acid that the bacteria could not make before the infection. This new ability was probably a result of _____.
 
End of Question 26


Question 27
27
Open Hint for Question 27 in a new window
Conjugation is a very effective process for spreading antibiotic resistance. Which statement best explains this observation?
 
End of Question 27


Clear Answers/Start Over





Pearson Copyright © 1995 - 2011 Pearson Education . All rights reserved.
Legal Notice | Privacy Policy | Permissions

[Return to the Top of this Page]